synapticÆther™ profile picture

synapticÆther™

I am here for Friends and Networking

About Me

..

I like...
getting wasted and writing code...
investigating cellular automata, artificial life, artificial intelligence, genetic algorithms, neural networks, and all things related to new life, transhumanism, posthumanism, and ground breaking technology...
listening to electronic music...
expanding my mind...
discussing conspiracies, politics, science, and world events...
discussing philosophy...
hanging out with Matt as much as humanly possible...
and most of all... Seiko ;).......................................................... ............................................................ ............................................................ ..........................................
011010010011010101110111110101010101010010101001001010110101 01 "At times I almost dream I too have spent a life the sages' way,
And tread once more familiar paths.
Perchance I perished in an arrogant self-reliance
Ages ago; and in that act a prayer
For one more chance went up so earnest, so...
Instinct with better light let in by death,
That life was blotted out -- not so completely,
But scattered wrecks, enough of it to remain
Dim memories, as now, when seems once more,
The goal in sight again."
You are techno!


What kind of techno music are you?
brought to you by Quizilla


THIS WAY UP
fusionAnomaly has fragile contents which may break!
Username:
From Go-Quiz.com

My Interests

My Conspiracy Space

New Extended trailer for the biggest movie of 2006!

..

Official Trailer for the biggest movie of 2006! ;)

..

Halloween 2004 :) lol

..

DJing, synthesizers, psychedelics, shamanism, turning on, tuning in, and dropping out.

December 21, 2012: ? -



I'd like to meet:

Seiko Brown ;)



Seiko Brown Gliss Promo
..
Add to My Profile | More Videos ............................................................ ............................................................ ....................... ............................................................ ............................................................ .......................... ............................................................ ............................................................ ..........................

.....and......


Anyone cool......
chances are we'll get along pretty great if you agree with or at least would discuss with me (without getting angry) the following things:
............................................................ ............................................................ ............
1.Evolution is real, and is happening now. The evidence is huge in amounts, and points clearly towards common descent.
............................................................ ............................................................ ...............
2.Intelligent Design is not Science, but creationism relabelled. It is lacking on a number of levels, does not provide good reasoning in its rebuttal of the evidence for evolution (of which there is a fucking ridiculous amount), nor does it specify what design is, or the shadowy 'intelligence' that is supposedly behind it.
............................................................ ............................................................ .........................
3.Any Religion that disagrees with scientific fact is no religion at all, but a means to control people.
............................................................ ............................................................ ......................
4.Humans are a part of the universe, not seperate, and are interconnected with each other (as well as everything else).
............................................................ ............................................................ ..........................
5.Quantum fluctuations slightly after the big bang led to the formation of the matter we see today. This is from a rapid expansion just after the big bang.
............................................................ ............................................................ ............................
6.George Bush is a fucking idiot.

and fuck cheney too!

fucking Pigs.....
"Ha Ha, Charade You Are"

Fake Osama Vs. Real Osama:
The Photo on the left is from the 9/11 confession videotape from 'osama'. The Photo on the right is how Osama looks in ALL of his other videos where instead of a confession, he says that he did not commit 9/11... So who committed 9/11?

...I'd also like to meet anyone who thinks that the official 9/11 story is true, show I can show you the ridiculous amount of evidence to prove that something very fucked up happened that morning, and either our government covered it up, or helped commit it. Do some research on WTC Building 7 before you email me though....

Here's some resesarch to begin with though: As early as September 23, 2001 four of the 'hijackers' had already been found "Alive and Well"... If many are still alive, why does our government still list them as those responsible for 9/11???:

BBC: 9/11 Hijackers "Alive and Well"



No building has ever been brought down from fire, including from plane impacts, but on 9/11, not 1, not 2, but 3 buildings collapsed at nearly free fall speed from fire. Building 7 did not even get hit by anything. There were a couple of small fires, and yet the building collapsed into a tidy little pile of rubble in 6.5 seconds? Building 7 also shows controllled demolition signs in the center buckling of the building just like in an implosion:

Videos even show demolition charges...

Do some research and question authority:

WTC Building 7 Information


WTC Videos



............................................................ ........... ............................................................ .

Music:

..

Electronic - Psytrance, Goa, Trance, Ambient, Breaks, Progressive House, House, Drum N Bass/Jungle, Techno, Electro, Happy Hardcore, Old Skool, etc... just a few are: Hallucinogen, Shpongle, Ott, Infected Mushroom, Astral Projection, Kraftwerk, The Chemical Brothers, The Crystal Method, Thievery Corporation, Unkle, Bedrock, Rabbit In The Moon, BT, Orbital, Future Sound of London, Dune, Dntel, New Order, Bedrock, Juno Reactor, the Prodigy, Uberzone, Ladytron etc... and various DJs : Sasha, John Digweed, Keoki, Tiesto, Oakenfold, Bad Boy Bill, Hernan Cattaneo, James Zabiela, John 00 Fleming, Gabriel & Dresden ... etc... and some rock: Pink Floyd, Black Sabbath + Ozzy, Jimi Hendrix, The Doors, Nirvana, Joy Division, The Cure, The Rapture, Interpol, The Killers, Green Day, The Bravery, The Pixies, The Clash, The Stone Roses, Nine Inch Nails, Hot Hot Heat, Garbage, Stars, LCD Soundsystem, My Bloody Valentine, The Mars Volta, The Secret Machines, Coldplay, Hood, Four Tet, Bright Eyes, Supersystem, Death Cab, The Postal Service, Marilyn Manson, Wreckless Eric, The Misfits, The Ramones, The Jesus and Mary Chain, Amorphis, Amorphous Androgynous, My Chemical Romance, The Caesars, Frou Frou, Kings of Leon, Sonic Youth, U2, The Shins, Oasis, Sublime ..................There is way too much other shit to list...

Movies:

Donnie Darko, Kill Bill vol 1 + 2, Sin City, Fahrenheit 9/11, Bowling For Columbine, 9/11 Loose Change, (and any other 9/11 conspiracy TRUTH (not theory) movies) What the Bleep Do We Know, Spun, Pi, The Matrix, Animatrix, Terminator 3, Better Living Through Circuitry, , the elegant universe, Groove, Liquid Crystal Vision, Human Traffic, Pink Floyd:Live @ Pompeii, Before Sunrise, Anything by M. Night Shyamalan, Napoleon Dynamite, + way more movies than I can list.

Television:

LOST, Six Feet Under, The Office: U.K. version, Arrested Development, Curb Your Enthusiasm, 24, The O.C., simpsons, strangers with candy, the daily show, Bill Maher, discovery science channel (and all cool documentary type programs, especially related to space)

Books:

Anything about shamanism, the universe, Evolution, spirituality, String Theory, Quantum Mechanics or Quantum Physics, Time Travel, Fibbonacci Sequence, Golden ratio of Phi, DNA, Extraterrestrials, etc...



Heroes:

Carl Sagan, Einstein, Timothy Leary, Terence McKenna, Socrates, Gandhi... basically anyone who questions authority and Opposes irrational stupid shit ............................................................ ................................. Armin van buuren, John Digweed, etc.. and basically any electronic music producers and DJs making real electronic music ............................................................ .............................. and anyone who voted AGAINST Bush



My Blog

College

Well I finally graduated from College... but... now what?I had a 4.0 GPA too. I had 6 A's this semester....
Posted by synapticÆther™ on Sat, 20 May 2006 09:36:00 PST

Prelude to a Renaisance Part 3:

Strong and weak coupling.     What is a coupling constant? This is some number that tells us how strong  an interaction is. Newton's constant is the coupling constant for the ...
Posted by synapticÆther™ on Sat, 20 Aug 2005 02:02:00 PST

Prelude to a Renaisance Part 2:

The Story So far, particles and relativity:       The story so far... particles and relativity . In the 18th and 19th centuries, Newton's mathematical description of motion ...
Posted by synapticÆther™ on Sat, 20 Aug 2005 01:59:00 PST

Prelude to a Rennaissance: The Universal Understanding That is Beginning to Materialize

A Brief History of Time from the Big Bang To String Theory:      The Planck Era and the Inflation Era: TIME: Planck time, about 10^-43 seconds      &n...
Posted by synapticÆther™ on Mon, 01 Jan 1900 12:00:00 PST

ASCII

                          ܲÛÛ          &n...
Posted by synapticÆther™ on Mon, 01 Jan 1900 12:00:00 PST

random stuff

Ive somehow managed to get the best (arguably) turntables on the market, technics sl1210m5g. Theyre fuckin great! Pop up blue LEDs and backlit blue pitch shifter are just icing on the cake. My mot...
Posted by synapticÆther™ on Mon, 01 Jan 1900 12:00:00 PST

The fibonacci sequence

...1-1-2-3-5-8-13-21-34-55-89-144-233-377-610-987.... is a sequence which is in just about everything. Exponential growth by adding the two previous numbers. When You represent these numbers as length...
Posted by synapticÆther™ on Mon, 01 Jan 1900 12:00:00 PST

Evolution

. Let's put all this hype about change and transformation in perspective. It's underhyped. A few billion years ago, the Earth was a big, sterile rock covered with puddles of chemical soup. Graduall...
Posted by synapticÆther™ on Mon, 01 Jan 1900 12:00:00 PST

Human Genome: First 1000 lines of Chromosome 1

GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA TCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT GTTTAATAGTACAG...
Posted by synapticÆther™ on Mon, 01 Jan 1900 12:00:00 PST

Freak Out: Genetic Memory

"I am beauty... What will you do with me?... must you kill me with your mind? must you kill me...kill me....kill me.....kill me" Where are you? did you get lost on the trip? did you get lost i...
Posted by synapticÆther™ on Mon, 01 Jan 1900 12:00:00 PST