Noah - ProfilesArchive

About Me

I work, I eat, I Listen to really bad music and love the hell out of it.

My Interests

coffee and squares

..
Get your own countUP at BlingyBlob.com

I'd like to meet:

NO ONE, we are all born to suffer and you all will HA HA Ha Ha aahhaaaaaa( well i thought it was funny)

Music:

The Angels Of Light, Swans, GIRA , the oblivians, dirtbombs, bassholes, gories, Dr. Know, bad brains, soledad brothers, hankIII, Jhonnyyyy CaSHHHH, flaming lips, Ramones, anything on dischord, anything on sympathy for the record industry, in the red records....yea i like the white stripes and you all can fuck off..fun fun rock and roll high school..A little slayer for night night time??? any one ever heard of dead horse? i have. THE DWARVES! zeke., new bomb turks.....the fuckers,old school punk(im fucking old)

Bo Didly, Bad livers,subhumanz, sub sonics....THE SONICS..pussy galore, jon spencer, man or astro man.. BIG BLACK..

Movies:

MARY POPPINS

Television:

you know what? i dont have a control device that is plugged in.

Books:

William WHo... BLAKE, Burroghs, Emmitt Fox, HOW to ReAd Body langiuge. dictonary-- not enough...Harry Crews, The Roaches Have No King, And The Ass Saw The Angle, The Koran, The Bible, 2004 edition Locomotive Rosters And News. Twenty four Hours A day, Edger Rice burroghs, Elric, John Carter Of Mars, EMD Parts Book, OK A Little Bukowski-dont tell, H P Lovecraft, POE, the late gonzo.... Bunny Yeager......

Heroes:

you

My Blog

99.99%

Lily is my daughter. Mica is soon to be my Ex-Wife 2 No more Ex Wives. Theres more to come, plans are being made and family will always be my priority. Turns out Mica will have to deal with me for a...
Posted by Noah on Fri, 11 Jan 2008 07:26:00 PST

DNA Day

GATCTTAGCTTTAAAGCCC write the complementary line below it giving:GATCTTAGCTTTAAAGCCCCTAGAATCGAAATTTCGGG Then, just read the lower line backwards (from right to left) giving the complement: GGGCTTTAAAG...
Posted by Noah on Thu, 20 Dec 2007 03:12:00 PST

Pics

All with my hand lightly holding you while inside your mother, in love even before you were born. Its so hard not to be filled with complete anger against your mother for the years of lies and deciet...
Posted by Noah on Tue, 18 Dec 2007 02:18:00 PST

66

66 Page 66 of the fourth edition"If we were to live, we had to be free of anger. The grouch and the brainstorm were not for us. They may be the dubious luxury of normal men, but for alcoholics these t...
Posted by Noah on Fri, 14 Dec 2007 11:25:00 PST

Sisyphus

"Sisyphus, we will recall, was a roguish king of Corinth who, because of his cruel ways, was condemned by the gods -- the judges of the dead, according to one version of the tale -- to push a boulder ...
Posted by Noah on Thu, 13 Dec 2007 08:02:00 PST

Thin Skin

I am a HOOKER, paper thin skin. Dont push to hard were it itches. its not automatic or is it a single action. just the ages of memory going numb from age. i am just a boy, not a man. a human insect w...
Posted by Noah on Wed, 24 Jan 2007 06:52:00 PST

STRANGULATEDBEATOFFS TORTURETAPEbySUGGESTION

So i read this article in Chunklet about make'n a torture tape. http://www.myspace.com/chunkletguy the first band that came to ...
Posted by Noah on Fri, 17 Nov 2006 09:23:00 PST

JackKnife

Semi-truck hunt on the drive to work. windows down doin 70. radio play'n combat white noise. i see'em up ahead a pack of three, they usualy run in packs. speed up to 90. white noise beat goes bump bum...
Posted by Noah on Wed, 02 Aug 2006 07:06:00 PST

how to destroy chipmunks.............

Might as well have a reason to hate me. Let me catch another furry little flea bag eating my Strawberry's!I left the pictures out.TrappingTrapping is the most practical method of eliminating chipmunks...
Posted by Noah on Wed, 28 Jun 2006 08:19:00 PST

Vafuk-N-cation

will be on a well deserved vacation to a remote beach in Florida for the next week (6-3-6 to 6-10-6) have a good night....
Posted by Noah on Fri, 02 Jun 2006 12:01:00 PST