Glenn profile picture

Glenn

The path of excess leads to the palace of wisdom.

My Interests

I'd like to meet:

Anyone interesting.

Music:

&lt punk mode &gt She Wants Revenge, My Chemical Romance, the Soviettes, Iggy Pop, Blue October, Blink-182

&lt chill-triphop mode &gt 311, Incubus, The Vines, Sum 41, The Nickel Slots

&lt hard mode &gt Disturbed, Thrice, Tool, Nine Inch Nails, Marilyn Manson, Godsmack, Korn

&lt kickback mode &gt Audioslave, Luna Halo, Corrosion of Conformity, Staind, Saliva, Fuel, Everclear, Metallica

&lt nostalga mode &gt Nirvana, Pearl Jam, Stone Temple Pilots, Soundgarden, Bush, Rage Against the Machine, R.E.M.

&lt jazz-blues mode &gt Miles Davis, John Coltrane, Mose Allison, Duke Ellington

Movies:

Office Space, Wedding Crashers, Van Wilder, Supertroopers, Requiem for a Dream, Clockwork Orange, The Godfather, Dead Poets Society, Thomas Crown Affair, Swordfish, Rounders, The Italian Job, Road To Perdition, Constantine, Memento, Good Will Hunting, The Score, American History X, Hitchhiker's Guide to the Galaxy, anything-IMAX

Television:

Mostly a Discovery Channel Geek
- Myth Busters, Survivorman, Extreme Engineering, Dirty Jobs

Doctor Who (A remake on SciFi that's a blast from the past; I remember watching this on the BBC when I was little)

24 (Just recently introduced to Season 1 on DVD. Dug it)

Books:

Waaaay too many to list and impossible to pick favorites. How about some current ones:
A Tour of the Calculus , David Berlinski
Pattern Recognition , William Gibson
The Complete Stories , Franz Kafka

Heroes:



My Blog

Photo of the Week: 4 Sept - 10 Sept

River otters basking in the sun at the Owls Creek Marsh Pavilion, part of the Virginia Marine Science Museum....
Posted by Glenn on Wed, 06 Sep 2006 10:31:00 PST

A week and a half away

The countdown is on!  Just 11 days until the Rock 'n Roll half marathon in Virginia Beach.  Here's the course:We'll see if anyone can beat the course record this year - a blistering 1:00:42 ...
Posted by Glenn on Wed, 23 Aug 2006 11:51:00 PST

Photo of the week: Aug14-Aug 20

Appetite for Destruction, a Guns 'n Roses tribute band, onstage at the Lincoln Theatre. Highly recommended for those of you interested in re-living the 80's for a night!photography portfolio @ Netherc...
Posted by Glenn on Mon, 21 Aug 2006 01:35:00 PST

Photo of the week: Aug 7-Aug 13

Alan Lewis of Vertigo USA, a U2 tribute band, playing at Alive after Five in downtown Raleigh.  Alan does a great job channeling Bono in both style and energy when not performing with his 70's gl...
Posted by Glenn on Mon, 21 Aug 2006 01:43:00 PST

GATCAATGAGGTGGACACCAGA

After a decade and a half, they've done it. This month, the last chromosome in the human genome has been sequenced. They saved a biggie for last - "chromosome 1" has 3,141 genes. That's about 8% of al...
Posted by Glenn on Thu, 18 May 2006 06:24:00 PST

Let's go Canes!

Woot!So the Carolina Hurricanes are in the Eastern Conference Finals w/ Buffalo. Individual tickets are getting kinda pricey at $90 for upper level, $175 for lower level sidelines.  I'm trying to...
Posted by Glenn on Mon, 15 May 2006 08:14:00 PST

I love hills

Wow. I'd enjoy having a little time alone with the guy who decided to include some of those hills in this race! I'm quite happy with my performance, and considering the terrain, I'm surprised I PR'd.I...
Posted by Glenn on Sun, 30 Apr 2006 07:57:00 PST

Gearing up!

The Elite Racing Rock 'n Roll Series - Nashville's Country Music MarathonToday is laundry day. Last day of work. A silly little 2-miler to stretch out the legs that have been itching to run all week. ...
Posted by Glenn on Wed, 26 Apr 2006 07:40:00 PST

Looking back

Looking back is something I try not to do often. I've just never seen a lot of value in wistful stares back down the path my life has taken. Now that's not to say I don't fondly remember lots of wonde...
Posted by Glenn on Sun, 23 Apr 2006 09:00:00 PST

The smell of springtime

Yes, I realize I already made a springtime post, but this is my blog. Meh.So let me catch you up. Sunday, as my astute readers may know, was my last slated loooooong run. A 20-miler, to be more specif...
Posted by Glenn on Wed, 12 Apr 2006 04:33:00 PST